BED, GFF, GTF, and GFF3 formats

GFF, GTF, GFF3 & BED files are all file formats that are used to store annotation (features) generally without containing any sequence. Although it is common that they will be accompanied by a fasta file containing the sequence only. They emerged as a way of exporting, or exchanging, information from a specified region of an entire genome without having to take the entire genome.

Most sequence formats were developed to be for a specific gene or protein. Although this is no longer true they are still orientated to be of a region of fixed length. These annotation files are not at all length specific and could potentially store just two features that were at either end of the same chromosome. They are a much more flexible way of dealing with annotation, especially a large amount, than a fixed length sequence format such as Genbank.

They also are not limited to a single sequence and can contain information from multiple sequences in the same file (Fasta files can also contain multiple sequences). For example you could store the entire human set of chromosomes in a pair of (quite large!) files. A multiple sequence Fasta file and a single GFF file.

The format of these annotation files does vary (who ever said Bioinformaticians had to be consistent!) but basically their format consists of a set of individual lines (one line per feature) along the following lines:

SEQUENCE ID, START, STOP, FEATURE TYPE, NOTE

Sequence ID is the sequence these annotations belong to.

START and STOP are the region of sequence they are annotated against

FEATURE TYPE is obvious! Note that this does not always correspond to a correct Genbank Feature Keyword

Genome Browsers

These tools (generally online web gateways) allow you to browse the entire chromosome or genome of a particular organism. Almost like a graphical model of a sequence database. All the information known about that particular organism’s sequence that has been submitted to one of the large sequence databases (e.g. Genbank at the NCBI) should be visualised within the genome browser. You can download all the annotation contained within a particular region fairly easily using one of these annotation formats. Then you can either annotate an existing file that you are working with (so preserving your own “private” annotation with all known public annotation).

To annotate a sequence with a BED/GFF/GFF3/GFT file in MacVector

From the UCSC’s Genome browser

The interface will change and show all annotation associated with that region. You can modify the amount or type of annotation being showed. This particular gene, C.elegans Sel-12 is located on Chromosome X

This will now allow you to export all the annotation associated with the previous displayed region (tracks).

If it is left at genome the entire genome will be downloaded

Now you need to open the sequence you want to annotate. For this example we could go to DATABASE > ENTREZ and search for and download Accession Number U35660. However, that only contains the mRNA and not the genomic sequence. So instead download the fasta sequence from the NCBI

Sequence : Chromosome: X; NC_003284.7 (915873..918235)

You will need to ensure that the start position of the downloaded file corresponds to the start of the region of the chromosome we have just downloaded the annotation for. This is easily done in MacVector.

Now we will import our downloaded annotation.

The Sequence ID (SeqID) contained within all features in the file will be shown in a dialog along with the number of features for each SeqID and the region of the sequence that these will be annotated against. A warning will be displayed if any of the features are outside of the region to be annotated.

A dialogue will be shown with the number of annotations that have been added. If you annotate a blank sequence (e.g. a fasta file) the resulting features may be initially hidden. However, you can easily show them from the Graphics Palette tree view.

You can choose to annotate your sequence with all the features contained within the imported file or to ignore duplicates.

ToxoDB Genome browser

Here’s a similar workflow from the ToxoDB Genome browser

Toxoplasma gondii ME49

"CCTTCCCTGCGTCAGAGGAGAAGAGAACGGCTTGACCGATGGAGGACCCCGCAAACATGAGGGCGAAGGTAGTCTGCATGATCTCTGAACAAGGAACACGGCGCGGAAAGGGAAGCACAGAAGGAAGTCGATCAAGACACCCTGCGTTGTTTTTCGGGGAGCCCCAGAGAGGGAGCTCGCGGCTCTGGACTTCAAGGTCCGTCGAGCAGCAGAACGCTTCACTCGGCAAGGAAGGAGCAGTTTCTTCTCTCGCGTCTTGTTTCGCTTTCACGGCTTCGTTTTCTCGCCGCGACCTGCGAAAAGAAAACAGCTCCCCTATAAGAACTCGACTCTCGAGCCTGCGGTTTGGTATCGGCTTTTTCTTCAGAGTTTTTTCTGTCGCGCGTTCGGACAACCAGTTCCGTGCTTGCGCGCCTCCTCTGAAGGCCGCGCCCGCCTCTCGACTCCCGTCGCTTCTCTCTTCGGCTGGATAAGAGAAAACGCTGAACGAAGAGGAGAGTACGCACTGGCATCGTTTGTCGACTTTCGTCTCCAGGTGGGGGAGTGTCGGTCGACTCACCCAAGGGATTCTTCCCTTCGCTGCTCACGATCTGGCCGCCATACCAAAAAATCAGCGCCTGCAGAGCGTACTGAGCTCCCTGACAGACACGCAGACGCAGCGGCAAGGAGACGCTGAAAAGAAGAAAGACAACCGGAGAGCGCGGAGAACAAAGAACTGTGAGCGTGCAACGACGGGATCAAGGACGACAGCGAATCTCCCGTCTTCAGGACCTCGACGGGCATTCCGCATGGCAGGTCCTTTGACTCCGAAAAACTCTGCGGCAGCCTCGATGACCCTTACCCCCCCGGAACATCCCCGAGAGCTCGGTGGAAAAAACCTCTCATTCGAGAGCGACAGATCAGGCTTTGCTAGTCGAGCCAGAAGGCAGGAGAAGGAACGGAGCGAACCGCGGATGCGTCTCTCTGCGCGGACGAGTCTTCATGAGCAGGCACCGCGACGTTCCAAGAAGCAGAAAGAGAGAGAGGAGAGAGGAGAGAAGCGAGAAGCTCGGGAACTCACGAGGAAGCAACAAAGATCTCTCCTCGTCACTCACGTTCCGTCGACCTGCATGGCAGGCGTGACGCGGCATGCACAGCAGAAGACCTTTCGAGGTCACCACACACACCGCCTCGGACGTCGAGAAGTCTCGATCTTTGTGAACCACAGGGCTCTGTTTTGTGTGGCGGAACGAAGAAACCAAGCGCTTAGGATGGAGCTCACTGGAGAGCAGGAAACGGATCTTCAAACGAGTGTCGACGTCCTCCCGCGCATCCGAACCGAAACTCAAACGCGCTCCAGAGAGACGACATAGAAGACAGAGACGTACAATGAGAGAAGAAGAGACAACGCGGCAGGGGGAGTCTGACGTCCGACCTCGACTCGAGAAGTCGCTCGCCAAAACGTGTGTGCAGTGTCTTCTGTTTCTTTCCAAGTTCTCCAGTCCGAAGAAACCGGACACTCTGACATGACTCGATACAGGGACCTGCCCGCCGACTCTTTCCTACTTTCAGCGGTCCTCCCTGTTCATCTTTCCTGTGACATTTCGGCATCTCTTTTTCTTGGTTTCCTCGCCTTCTCACCTGACTGAAGCCCCAGAAAAAGCCGAGGAGAGCCGCAGCGCGCTCTTCTTCCTTCAGCGTCCTCAGAAGAACGCTCTGGTACCGTTCCGTGAAGTGAGGCTCTAAACCGAACGCTGAAACAATGCGAATACCGTTCAGAGCCTCGCTCATCACGAAGGCAGCGGTGTCGCGGTCCTCCACCTTCTCCGCCTTCTTGTTCGCCCCCTCACCTGCAGAAAAAACTCCAAGGTTTCCAAAGCCTCGTGAGGCTCCCCATGAAGCTCTCCGCCTACGCTTGCGCAGATTGAGGCAGAGCAAACTACGCAAATGTGAGCCTACATGTACACACAGTTTCGTCGAGATTTGTACCTATATCTAAGAAGATTTGTACGGAAATGCGGGTGTGAAGCGGCAGTTTTCGAGGTGGCGTGCATACATCGACGCGACTCGGAGACCCAGCTTTGAGGAGACAGGAGAGAGAAAAGGAAACGGAGATAGAGCAGGTGGGGAGATCAGGTTTGCTCTGGGAGACGTGGACGGTCGCAGACGAAGAAGCAGACGCACGGAGCGAGCAGTGCAAAAAAGCGCGAGACAGAGCCGGCGCTGGGGAACTTCTGAGGAAGAATTCGAGAGAGAGAGGACCGTGGTGAAAAGCCAAGCTAAACGCGTGGACTTCCAGTTCTGCGGACTTTTCGGAGCCGAAATGTGAGACTGAGCGGCAGTGGCGGGGAGCAGAAGAACAAAACATGCGAGGACCACGGCGGCCAAGCGCGCGTCTCCAAAGAACGCGATGATGACACCTGAAATAAAGATAATGGAAAAAACAGAAGAAAAGCAACGGTCTCTCGCGCAGTCTTCAATCACGAGTTGACGCACACACGCATTAGGGGAGAACAACCTCTGCGATGTTGGATGCTTCTTTAGTGAGTGGACGTTTCCAGAAATCAAATCAAAGTAGCACGACACCGACAAGCAAAGAGATGTATACTTTCGTTCACGAGCACTGAAAGACGCGTCTAGACGCCTACGGATGCAGAGGGATCTGAAGCGACGAGTGAACAGTCAAAAAGCTTTCCGGCCTACCAGTGACAACAGCAGCCAATCCCTGGGTCATCGCGAGTGCGTTTCCAGCGCTTCCTGTCTTGACGAGAAGGACGTCGCTGGAGAGAACTCCCGTGAGATATCCTGAGGTCATTTTTTAGAAGAAGCGAACACTCTGGCGCGGCGTCTTCACTCTCGTGCTCACAGAAAGAATGAACTCACGAGACCCATGGCAGGACAAGTCTCAGACAGACACACAC"

This will find a single hit and display a link

You can use FILE > NEW FROM CLIPBOARD to bring the sequence into MacVector quickly

Again if you do not change the start coordinate of the sequence the IMPORT FEATURES dialogue will show an error

The dialogue will show that it has found 6 features. Note that the GFF3 file contains annotation from a much longer sequence than our initial query sequence. MacVector will ignore any annotations that lies outside the query sequence. It will show an warning message to indicate this.

Keeping a sequence updated

You will be able to “update” and add new annotation to your existing sequence. For example after a few months I could revisit these two genome browsers website and download an updated GFF3 file. Upon importing these features it will optionally replace any duplicate features and add new ones. So you can work with a sequence and also keep it updated as other researchers find more about this particular sequence.

Duplicate Features

Due to the lack of strict standards across the many different file formats it may be that a potential duplicate is not recognised as such because the wording or keyword is different. In the majority of cases some degree of manual curation of the annotated sequence will be required. In all cases MacVector will err on the side of caution and will never throw away any potentially interesting or important information contained within a feature. Only entries that are 100% the same (after being parsed during the import) will be considered as duplicates. MacVector will never class a feature as a duplicate if the START, STOP or FEATURE TYPE are different in any way. Even if they differ by just a single base.

Come visit us if you are at the show. Our booth at the ASM will be 936.

We’ll be demoing MacVector 12.6 which will be released about that date. You’ll also be able to pick up demo CDs and incubator floaties. We are giving away some cool mouse pads with a summary of the DNA and Protein IUPAC codes and the Universal Genetic Code printed on them for quick reference.

This year it looks like the Twitter hashtag will be #asm2012. As ever you can follow us on @macvector

If you are attending the meeting do pop along and say hi. See you in a month!

Apple started transitioning their processor architecture from PowerPC (PPC) to Intel’s x86 in 2006. The Macbook Pro and the iMac being the first Intel Macs. When they did so they gave Xcode (the OSX development environment) the ability to create Universal Binary application. These contain native executables for both PPC and x86 CPUs. So giving these applications the ability to run natively on both types of Mac.

However, to support earlier applications that had only been available as PPC executables they included a PPC Emulator called Rosetta (named after the Rosetta Stone). This allowed PPC only applications to run on Intel x86 Macs.

OS X 10.5 Leopard was the last release of OS X that was distributed as a Universal Binary OS. With OS X 10.6 Snow Leopard being a x86 only release. That is it will not run on PPC Macs. Even so they kept Rosetta as an optional install (previously it was installed by default). However, OS X 10.7 Lion does not include Rosetta and you cannot install earlier versions. This means that PPC applications will no longer run on Lion. In reality this is only applications that are over six years old.

MacVector 9.5 (released in 2006) was the first Universal Binary version of MacVector. Previous versions are PPC only and will not run on Lion.

If you are running such an old version of MacVector then your options are limited to either upgrading MacVector or not upgrading to Lion. You can still upgrade such an old version of MacVector at a significant discount. Contact Sales to request a quote or visit the website. There’s many other reasons to upgrade as well. The interface has changed substantially since MacVector 9.5 being more powerful and easier to use. There’s also many new tools with enhancements to older ones. The latest release is MacVector 12.5 and this release has improvements to sequence assembly (support for NGS reference assemblies using Bowtie) and extra options for multiple sequence alignment with Muscle and T-Coffee added.

Technorati Tags: apple, lion, OSX, Universal Binary

So after you’ve chatted about the holidays with your colleagues have a slow start to 2012 and take the opportunity to keep your copy of MacVector up to date. MacVector 12.5 was released at the end of last year. So if you’ve not yet done so then do so here! It’s also a good idea to run a few system maintenance tasks to make sure your Mac is running great.

Happy New Year!

We have a lot to look forward to in 2012. MacVector 12.6 will be released in the first quarter of 2012 with some great new primer design tools. We’ve also got another release planned for the backend of the year.

But for now, we thank you and we wish you a prosperous, happy and enjoyable New Year from the whole MacVector team.

But before we all break for the end of the year remember that we’ve just released MacVector 12.5. You’ve probably seen the release via Software Update inside MacVector but if not you can download it from our website if your license is valid for this release or download a 21 day trial.

Technorati Tags:MacVector

Credit: Matthew Yohe

Technorati Tags: apple

Technorati Tags: Deals, lion, MacVector, OSX

Nonetheless even though we’ve not yet come across any issues we are committed to fixing bugs. So if you are running MacVector 12 and have already updated to Lion then please do not hesitate to email us or comment on this blog if you find a bug, even if it’s just a little niggle.

If you are not running MacVector 12 then there are some issues. Lion does not include Rosetta and because of this if you are using MacVector 9.5 or earlier then this will definitely not work on Lion.

MacVector versions between 10, 10.5 and 10.6 may still work although these have not been tested yet. MacVector 11 and 11.1 appear to work although it is possible that there are issues.

So before you upgrade your Mac make sure you upgrade your copy of MacVector and discover why MacVector 12 is the best and easiest to use version of MacVector yet!

Why upgrade MacVector?

MacVector has always been designed to be the easiest sequence analysis application to use on the Mac. With the latest release MacVector’s strengths are:

- Graphics: displaying feature rich annotated sequences with a sequence overview allowing you to see your full sequence at a glance

- Subcloning: A point and click interface allows you to select RE sites, digest, then ligate into a vector with ease! Compatible sites are highlighted with a Klenow blunting tool if there are none. MacVector also supports Gateway and TOPO cloning.

- Comparing sequences: You can align cDNA/mRNA/EST clones against genomic sequences, Blast your sequence, search and align against multiple sequences on your hard drive, generate dot plots and much more. Assemble reads against a template sequence with easy SNP analysis.

- Open your data from many sources: direct from Entrez, from Vector NTI databases, from many sequence formats (e.g. GenBank, EMBL, GCG etc) or from sequencing facility files in Fastq, ABI or SCF formats.

- Sequence Annotation: A wide array of algorithms combined with the drag and drop of results to your sequence makes it a quick process to annotate your blank sequence with features. Auto annotation lets you quickly annotate new sequences based on your own collection of curated sequences.

- Designing primers: Click on a feature in your sequence, run the analysis and get a ranked graphical list of the best primer pairs to amplify that feature. You can also design internal hybridisation primers for realtime PCR analysis with additional functions to check/design sequencing primers.

- Sequence assembly: there are tools to easily create de novo assemblies in a few steps or simply compare your sequencing results against the template of your new construct.

The cheapest time yet to upgrade

If all those features are not enough then to help you upgrade we are offering a discount on all upgrades. Upgrade before the end of September and we’ll give you a 25% discount on even very old copies of MacVector. This means you can upgrade to MacVector 12 for as little as $450*

To upgrade request a quote and enter LionUpgrade in the promotional code box

Remember all upgrades of MacVector also include 12 months of free upgrades. This means upgrading now means that you will receive MacVector 12.5 which is due for release later this year.

….and as well!

If you are not convinced about upgrading your copy of MacVector then if you request a quote by the end of August we’ll send you a mousepad to help you remember that which codon stands for Aspartate…..

…and when we receive your order we’ll add a floatie for your water baths!

*For upgrading MacVector 8.1 or higher in the US. Please contact sales@macvector.com for other pricing.

Technorati Tags:
MacVector, lion, OSX