Using the Find dialog

For quickly finding a single primer in a sequence the Find dialog is the first point of call. This allows you to find any sequence, whether it binds to the complementary strand, it is reversed or both. It also allows you to state which end of the sequence to start from and in which direction to scan the sequence (not necessarily obvious!). The Find dialog (see below) is a little daunting to look at first (in fact due to recent user feedback we will hiding most of the functionality in the next release). However, it is very powerful and in most cases you do not need to change anything as the default settings will work for the majority of cases.

To use find:

(i) open up your sequence and use the menu option EDIT > FIND or use the key combination CMD – F

(ii) Enter your primer sequence in the FIND box and click FIND.

When to use: When you need to find a single primer very quickly and do not need to store the results

Benefits: quick and easy to use

Limitations: You can only find a single primer. Only perfect matches are allowed. No primer statistics.

Align to Reference

If you want to quickly align a large set of primers against a template sequence, then as long as each primer is in a separate MacVector file, or a multi sequence fasta file then you can use Sequence Confirmation in the Align to Reference function:

(i) Open the template file and go to ANALYZE > ALIGN TO REFERENCE

(ii) Import your primer sequences.

(iii) Click on ALIGN

(iv) Change the drop down menu to Sequence Confirmation then change these parameters:

- MATCH to 5.

- SENSITIVITY to 10.

- If you suspect your primers may not be a perfect match then reduce SCORE THRESHOLD until your primer aligns.

The resulting alignment will show your primers aligned against the template. You can switch to the Map view to show a graphical overview of all your primers and where they are located on the sequence. You can use the Editor view for a sequence level representation of the primer aligned against the template.

When to use: When you need to find many primers over a large sequence

Benefits: Easy to visualize a great quantity of primers against a template

Limitations: Your primer sequences need to be in a file already. No primer statistics.

Analyze Primer->Test PCR Primer Pair..

This function is fairly easy to use and gives a large amount of detail about your primers. For example secondary structure, what size the product will be and even the most ideal Tm for your PCR run.

(i) Open your sequence and go to PRIMERS > Test PCR Primer Pairs

(ii) Copy and paste your two sequences in the two boxes. Note you will need to have pasted them into an external application.

(iii) Click APPLY and see your primers detailed statistics.

(iv) Click OK to see the full statistics on the primers and product.

Primer pair details:
	Major product size: 538 bp

Product details:
[  1] primer 1: score 20, mismatches 0, upper strand 1055 to 1074
				Tm: 51.4 deg C (from target sequence)
				The 3' end of the primer binds within the product
	  primer 2: score 20, mismatches 0, lower strand 1592 to 1573
				Tm: 51.7 deg C (from target sequence)
				The 3' end of the primer binds within the product
	  Tm difference of pair: 0.3 deg C
	  Product:  538 bp (1055 to 1592)
				Optimal annealing temp:   55.0,
				pct G+C:   46.7          	Tm:   77.8 deg C

       5'  -GGTCCACTTCGTATGCTGGT- 3' (primer 1)
            ||||||||||||||||||||
  1055 5'-..GGTCCACTTCGTATGCTGGT..<-   498bp ->..
       3'-..CCAGGTGAAGCATACGACCA..             ..

                         ..CATCACCTTTGGGCTTGTTT..   1592
                         ..GTAGTGGAAACCCGAACAAA..
                           ||||||||||||||||||||
                       3' -GTAGTGGAAACCCGAACAAA- 5' (primer 2)

When to use: When you need detailed output about a pair of primers and their product. Including recommended Tm for the annealing stage of the PCR.

Benefits: highly detailed output about primers and product

Limitations: You can only analyze a pair of primers.

Nucleic Acid Subsequence search

Subsequence searching allows you to find any significant region with a consensus sequence, in your sequence. This function allows you to keep a library of sequence patterns of either nucleic acid or proteins. You can use subsequences with complex patterns for the search as this function uses a powerful nomenclature (similar to Prosite’s) for creating patterns. Furthermore each pattern can have up to three distinct segments, separated by variable inter-segment regions, and you can control the overall similarity required for a match as well as defining residues which must be 100% conserved.

A common usage of this function is storing a library of primers.

You can easily create such a library by creating a CSV file of your primers. Then you can use the Primer Convertor tool to convert this CSV file into a subsequence file. Primer Convertor is supplied with MacVector, however, you can download an updated version of this utility from here.

Once you have created this file then use these steps to find primers in any sequence:

(i) Open up your sequence

(ii) Select ANALYZE.. > SUBSEQUENCE.

(iii) Choose your subsequence file and click OK.

When to use: When you have a need to repeat the same set of primers multiple times against different sequences

Benefits: Easy way to perform regular analyses

Limitations: You need to prepare a subsequence file containing all your primers.

Design Primers (Primer3)

Currently Design Primers (Primer3) is not very flexible when it comes to testing primers as opposed to designing them. There are no preset defaults for testing primers. However, it is a powerful tool and will uniquely allow you to design a new primer to match an existing primer. To use this tool you need to change the default settings which are meant to design a pair of primers to amplify the selected sequence.

If you just want to test a pair of primers and you have no other criteria:

(i) Select ANALYZE > PRIMERS > DESIGN PRIMERS (PRIMER3)

(ii) Change the drop down menus of each primer field to USE THIS PRIMER and paste in your primers

(iii) Select REGION TO SCAN from the design method drop-down list.

(iv) Change area to scan to be the full length of your sequence.

(v) Ensure that the REGION TO SCAN values entirely encompasses the area that contains the expected product (easiest way is to select the entire sequence).

(vi) Ensure that the PRODUCT SIZE limits are above and below the expected product size (TIP: make them generously above and below).

If you do have a specific product in mind, then:

(i) Select the feature that you want to amplify.

(ii) Select ANALYZE > PRIMERS > DESIGN PRIMERS (PRIMER3).

(iii) Change the drop down menus of each primer field to USE THIS PRIMER and paste in your primers.

or

(iii) If you want to design a primer to match an existing primer change the drop down menu of your existing primer field to USE THIS PRIMER and paste in your primer. Leave the other drop down menu to FIND PRIMER.

(iv) If you know your primers are either 200bp upstream or downstream from the 5′/3′ end of your feature then keep AMPLIFY FEATURE otherwise select FLANKING REGIONS from the design method drop-down list and enter a large value for each region.

The above steps are more complex than they should be. However, most settings are preserved between runs, and the next time you run it the settings will already be correct.

When to use: When you need to easily visualize a pair of matching primers and their product

Benefits: nice visualisation of primers and product

Limitations: You can only analyze a pair of primers. Some of the output is limited for example you will not find the recommended Tm.

Technorati Tags:
MacVector, pcr, primer3

Many labs have collections of commonly used primers, and one popular use of subsequence searching is to store these primers in a subsequence library. This makes it a simple procedure to scan a sequence with the entire lab’s primer library.

It is fairly easy to create a single subsequence. However, if you have many it is time consuming to do this manually. So we have an application called PrimerConverter (that is included with MacVector) that is designed specifically for batch conversion of many primer sequences. All you need is a comma delimited text file of your primer sequences. The CSV file needs to be in the following format:

<name>, <sequence> (, <optional comment>)

So a sample file might look like:

Primer 1, AGCTGGATCGATCGATCGTAGCT, My primer 1 comment
Primer 2, TTCGGGCTAGGCTAGCTAGGGC
Another primer, AAAGCTAGCTAGCTAG, this is the last one

Open this file with PrimerConverter and then save it as a MacVector Subsequence file. The application is included with MacVector, however, you can download an updated version of this utility from here.

As well as indicating the number of mismatches allowed Subsequence searching also allows you to choose which residue of a match needs to match perfectly. For the CSV file you can set residues to be lower case to indicate they don’t have to be perfect matches.

For example the following CSV file input:

Primer_example, AGCTGGAtCGAtcgaTCGTAGCT, primer with five mismatches allowed.

Will produce the following subsequence

Make sure that the Allowed Mismatch field is set appropriately (the default will be to allow only the characters that do not need to match perfectly). You must be using the above release of PrimerConvertor to do this.

Here’s an example done with eight primers against the template

Technorati Tags:
MacVector

Design Primers (Primer3)

The most flexible tool was introduced in MacVector 10. It provides a interface to Primer3. The dialogue is meant to be as flexible as possible and can cope with testing, designing, and even to find matching primers for a known one. You can also design internal primers for use in realtime and qPCR.

Out of all the primer tools Design Primers (Primer3) is the most tightly integrated into the MacVector point and click way of working. From the Map view you can design a pair of primers to amplify a feature in as little as three mouse clicks.

PCR Primer Pairs

PCR Primer Pairs has been in MacVector for many versions. The output is a text file and a graphical non-interactive map, however, it is very detailed and shows extra information that you may need. For example it will provide the optimal Tm to use for your PCR (rather than the Tm of your product and primer sequences). By default this tool will show pairs of primers to produce a specific product size, rather than amplify a certain region. To do this you need to specify two flanking regions.

Test PRIMER PAIRS

Whereas the output from this tool is fairly rudimentary, it does provide extra data about your primers that Design Primers will not. For example the optimal Tm to use for your PCR. It will also supply details about which bases could potentially form primer-primer or primer-dimer bonds. It will also show a more detailed view of the actual alignment formed between primer and template. Use this tool if Design Primers fails with stringent primer-primer interaction values.

Sequencing Primers/Probes

So far this is your only option for designing sequencing primers in MacVector. It produces a fairly detailed report, but does not show the actual location of the priming site.

Test Sequencing Primers/Probes

Again this is your only option for testing an existing sequencing primer. It produces a fairly detailed report that is similar to the text report provided by Test PRIMER PAIRS.

In the next post I’ll talk about Primer3 in more detail and how to design pairs of primers for usual cases. I’ll also show you some tips to get more out of this tool.

Technorati Tags:
pcr