As mentioned in a recent post MacVector has a powerful feature called Subsequence searches. This function allows you to keep a library of sequence pattern matches, using a powerful nomenclature with up to three parts, and quickly scan protein and nucleic acid sequences with this library. .Although MacVector ships with a number of collections of interesting sites of both proteins and genes you can easily create your own subsequence files.
Many labs have collections of commonly used primers, and one popular use of subsequence searching is to store these primers in a subsequence library. This makes it a simple procedure to scan a sequence with the entire lab’s primer library.
It is fairly easy to create a single subsequence. However, if you have many it is time consuming to do this manually. So we have an application called PrimerConverter (that is included with MacVector) that is designed specifically for batch conversion of many primer sequences. All you need is a comma delimited text file of your primer sequences. The CSV file needs to be in the following format:
<name>, <sequence> (, <optional comment>)
So a sample file might look like:
Primer 1, AGCTGGATCGATCGATCGTAGCT, My primer 1 comment Primer 2, TTCGGGCTAGGCTAGCTAGGGC Another primer, AAAGCTAGCTAGCTAG, this is the last one
Open this file with PrimerConverter and then save it as a MacVector Subsequence file. The application is included with MacVector, however, you can download an updated version of this utility from here.
As well as indicating the number of mismatches allowed Subsequence searching also allows you to choose which residue of a match needs to match perfectly. For the CSV file you can set residues to be lower case to indicate they don’t have to be perfect matches.
For example the following CSV file input:
Primer_example, AGCTGGAtCGAtcgaTCGTAGCT, primer with five mismatches allowed.
Will produce the following subsequence

Make sure that the Allowed Mismatch field is set appropriately (the default will be to allow only the characters that do not need to match perfectly). You must be using the above release of PrimerConvertor to do this.
Here’s an example done with eight primers against the template

Technorati Tags:
MacVector

