Check out this blog post!
We’d love to meet the Genomic Repairman and thank him for his glowing testimonial. I would also add that PC users won’t be SOL for long. MacVector4Windows is in the pipeline.
Tags
My first child shall be called MacVector
Posted in General
Comments closed
Aligning primers against a template sequence
A common request, especially in our recent survey, is to align existing primer sequences against a template sequence. There are many ways to do this in MacVector, depending on what your requirements are
Using the Find dialog
For quickly finding a single primer in a sequence the Find dialog is the first point of call. This allows you to find any sequence, whether it binds to the complementary strand, it is reversed or both. It also allows you to state which end of the sequence to start from and in which direction to scan the sequence (not necessarily obvious!). The Find dialog (see below) is a little daunting to look at first (in fact due to recent user feedback we will hiding most of the functionality in the next release). However, it is very powerful and in most cases you do not need to change anything as the default settings will work for the majority of cases.
To use find:
(i) open up your sequence and use the menu option EDIT > FIND or use the key combination CMD – F
(ii) Enter your primer sequence in the FIND box and click FIND.
When to use: When you need to find a single primer very quickly and do not need to store the results
Benefits: quick and easy to use
Limitations: You can only find a single primer. Only perfect matches are allowed. No primer statistics.
Align to Reference
If you want to quickly align a large set of primers against a template sequence, then as long as each primer is in a separate MacVector file, or a multi sequence fasta file then you can use Sequence Confirmation in the Align to Reference function:
(i) Open the template file and go to ANALYZE > ALIGN TO REFERENCE
(ii) Import your primer sequences.
(iii) Click on ALIGN
(iv) Change the drop down menu to Sequence Confirmation then change these parameters:
– MATCH to 5.
– SENSITIVITY to 10.
– If you suspect your primers may not be a perfect match then reduce SCORE THRESHOLD until your primer aligns.
The resulting alignment will show your primers aligned against the template. You can switch to the Map view to show a graphical overview of all your primers and where they are located on the sequence. You can use the Editor view for a sequence level representation of the primer aligned against the template.
When to use: When you need to find many primers over a large sequence
Benefits: Easy to visualize a great quantity of primers against a template
Limitations: Your primer sequences need to be in a file already. No primer statistics.
Analyze Primer->Test PCR Primer Pair..
This function is fairly easy to use and gives a large amount of detail about your primers. For example secondary structure, what size the product will be and even the most ideal Tm for your PCR run.
(i) Open your sequence and go to PRIMERS > Test PCR Primer Pairs
(ii) Copy and paste your two sequences in the two boxes. Note you will need to have pasted them into an external application.
(iii) Click APPLY and see your primers detailed statistics.
(iv) Click OK to see the full statistics on the primers and product.
Primer pair details: Major product size: 538 bp
Product details: [ 1] primer 1: score 20, mismatches 0, upper strand 1055 to 1074 Tm: 51.4 deg C (from target sequence) The 3' end of the primer binds within the product primer 2: score 20, mismatches 0, lower strand 1592 to 1573 Tm: 51.7 deg C (from target sequence) The 3' end of the primer binds within the product Tm difference of pair: 0.3 deg C Product: 538 bp (1055 to 1592) Optimal annealing temp: 55.0, pct G+C: 46.7 Tm: 77.8 deg C
5' -GGTCCACTTCGTATGCTGGT- 3' (primer 1)
||||||||||||||||||||
1055 5'-..GGTCCACTTCGTATGCTGGT..<- 498bp ->..
3'-..CCAGGTGAAGCATACGACCA.. ..
..CATCACCTTTGGGCTTGTTT.. 1592
..GTAGTGGAAACCCGAACAAA..
||||||||||||||||||||
3' -GTAGTGGAAACCCGAACAAA- 5' (primer 2)
When to use: When you need detailed output about a pair of primers and their product. Including recommended Tm for the annealing stage of the PCR.
Benefits: highly detailed output about primers and product
Limitations: You can only analyze a pair of primers.
Nucleic Acid Subsequence search
Subsequence searching allows you to find any significant region with a consensus sequence, in your sequence. This function allows you to keep a library of sequence patterns of either nucleic acid or proteins. You can use subsequences with complex patterns for the search as this function uses a powerful nomenclature (similar to Prosite’s) for creating patterns. Furthermore each pattern can have up to three distinct segments, separated by variable inter-segment regions, and you can control the overall similarity required for a match as well as defining residues which must be 100% conserved.
A common usage of this function is storing a library of primers.
You can easily create such a library by creating a CSV file of your primers. Then you can use the Primer Convertor tool to convert this CSV file into a subsequence file. Primer Convertor is supplied with MacVector, however, you can download an updated version of this utility from here.
Once you have created this file then use these steps to find primers in any sequence:
(i) Open up your sequence
(ii) Select ANALYZE.. > SUBSEQUENCE.
(iii) Choose your subsequence file and click OK.
When to use: When you have a need to repeat the same set of primers multiple times against different sequences
Benefits: Easy way to perform regular analyses
Limitations: You need to prepare a subsequence file containing all your primers.
Design Primers (Primer3)
Currently Design Primers (Primer3) is not very flexible when it comes to testing primers as opposed to designing them. There are no preset defaults for testing primers. However, it is a powerful tool and will uniquely allow you to design a new primer to match an existing primer. To use this tool you need to change the default settings which are meant to design a pair of primers to amplify the selected sequence.
If you just want to test a pair of primers and you have no other criteria:
(i) Select ANALYZE > PRIMERS > DESIGN PRIMERS (PRIMER3)
(ii) Change the drop down menus of each primer field to USE THIS PRIMER and paste in your primers
(iii) Select REGION TO SCAN from the design method drop-down list.
(iv) Change area to scan to be the full length of your sequence.
(v) Ensure that the REGION TO SCAN values entirely encompasses the area that contains the expected product (easiest way is to select the entire sequence).
(vi) Ensure that the PRODUCT SIZE limits are above and below the expected product size (TIP: make them generously above and below).
If you do have a specific product in mind, then:
(i) Select the feature that you want to amplify.
(ii) Select ANALYZE > PRIMERS > DESIGN PRIMERS (PRIMER3).
(iii) Change the drop down menus of each primer field to USE THIS PRIMER and paste in your primers.
or
(iii) If you want to design a primer to match an existing primer change the drop down menu of your existing primer field to USE THIS PRIMER and paste in your primer. Leave the other drop down menu to FIND PRIMER.
(iv) If you know your primers are either 200bp upstream or downstream from the 5’/3′ end of your feature then keep AMPLIFY FEATURE otherwise select FLANKING REGIONS from the design method drop-down list and enter a large value for each region.
The above steps are more complex than they should be. However, most settings are preserved between runs, and the next time you run it the settings will already be correct.
When to use: When you need to easily visualize a pair of matching primers and their product
Benefits: nice visualisation of primers and product
Limitations: You can only analyze a pair of primers. Some of the output is limited for example you will not find the recommended Tm.
ANOTHER NOVEMBER SPECIAL OFFER: Buy or upgrade MacVector and receive Assembler for free…..
Quite a few users have asked why we are only having an offer to upgrade old network licenses rather than any licenses. We do not want to upset people and so we’re allowing anybody who upgrades a standard license in November to receive a free copy of Assembler when they do so. We’re also being generous to new users and giving anybody who purchases a new license of MacVector an extra 10% discount AND a free copy of Assembler.
All these alternative offers include a free upgrade to MacVector 12 when it comes out before the end of the year.
This offer is only valid until the end of November. Please email sales@macvector.com mentioning this offer if you would like a quote sent or have any questions.
Technorati Tags:
MacVector
Clustering an alignment
Sometimes it is useful to sort, or cluster, an alignment according to the similarity/identity of its sequences. With such a sorted alignment you are able to more easily visualise closely related sequences as they will be together in an alignment with more distantly related sequences being much further apart.
If you want to quickly cluster a sequence alignment in MacVector then you can use a phylogenetic tree to do this.
– Take your sequence alignment and run a phylogenetic reconstruction. In the MSA editor click the TREE button or run the menu command:
ANALYZE > CONSTRUCT TREE
– From the resulting phylogenetic window, you can rearrange sequences if necessary by selecting nodes and “rotating” them with the toolbar buttons.
– Then, with the focus on the Phylogeny window, sort the alignment to match the tree using the Sort MSA toolbar button or using the menu command:
ANALYZE > PHYLOGENETIC ANALYSES > SORT MSA TO MATCH TREE
This will rearrange the sequences in the editor to match the phylogeny branches.
Technorati Tags:
MacVector
Creating your own subsequence library of primers
As mentioned in a recent post MacVector has a powerful feature called Subsequence searches. This function allows you to keep a library of sequence pattern matches, using a powerful nomenclature with up to three parts, and quickly scan protein and nucleic acid sequences with this library. .Although MacVector ships with a number of collections of interesting sites of both proteins and genes you can easily create your own subsequence files.
Many labs have collections of commonly used primers, and one popular use of subsequence searching is to store these primers in a subsequence library. This makes it a simple procedure to scan a sequence with the entire lab’s primer library.
It is fairly easy to create a single subsequence. However, if you have many it is time consuming to do this manually. So we have an application called PrimerConverter (that is included with MacVector) that is designed specifically for batch conversion of many primer sequences. All you need is a comma delimited text file of your primer sequences. The CSV file needs to be in the following format:
<name>, <sequence> (, <optional comment>)
So a sample file might look like:
Primer 1, AGCTGGATCGATCGATCGTAGCT, My primer 1 comment Primer 2, TTCGGGCTAGGCTAGCTAGGGC Another primer, AAAGCTAGCTAGCTAG, this is the last one
Open this file with PrimerConverter and then save it as a MacVector Subsequence file. The application is included with MacVector, however, you can download an updated version of this utility from here.
As well as indicating the number of mismatches allowed Subsequence searching also allows you to choose which residue of a match needs to match perfectly. For the CSV file you can set residues to be lower case to indicate they don’t have to be perfect matches.
For example the following CSV file input:
Primer_example, AGCTGGAtCGAtcgaTCGTAGCT, primer with five mismatches allowed.
Will produce the following subsequence
Make sure that the Allowed Mismatch field is set appropriately (the default will be to allow only the characters that do not need to match perfectly). You must be using the above release of PrimerConvertor to do this.
Here’s an example done with eight primers against the template
Technorati Tags:
MacVector
Jaspar, MacVector & Subsequence searches
MacVector allows you to find motifs, primers, transcription factor binding sites, or any significant region with a consensus sequence, in your sequence using a powerful feature called subsequence searches. This function allows you to keep a library of sequence patterns of either nucleic acid or proteins. You can use subsequences with complex patterns for the search as this function uses a powerful nomenclature (similar to Prosite’s) for creating patterns. Furthermore each pattern can have up to three distinct segments, separated by variable inter-segment regions, and you can control the overall similarity required for a match as well as defining residues which must be 100% conserved. Although you can easily create your own subsequence files of your own regions MacVector also ships with a number of collections of interesting sites of both proteins and genes.
In our recently completed survey one common request was promoter analysis. MacVector has subsequence files of transcription factors for analysis of promoter regions. MacVector includes some transcription factor subsequence files and recently we have also added the Jaspar transcription factor database. This open database is available as a set of profiles, however, we have converted this to a subsequence library. By its nature searching using a regular expression match is less sensitive than a profile based search. However, MacVector does possess a profiles search so if you are looking for a particular transcription factor site, then you can search with a profile from the set of the original Jaspar profiles (in TRANSFAC profile format) that are also supplied. This function that will take one or two profiles and search a sequence for likely binding sites of those profiles.
The most recent Jaspar subsequences and profiles were generated from the JASPAR_CORE 2010, All_Species redundant set of profiles. This is described on the Jaspar website:
“The JASPAR CORE database contains a curated, non-redundant set of profiles, derived from published collections of experimentally defined transcription factor binding sites for eukaryotes. The prime difference to similar resources (TRANSFAC, etc) consist of the open data access, non-redundancy and quality.”
The Jaspar subsequence files will be freely downloadable from our downloads page.
Stop by the MacVector booth #802 at the NIH Research Festival this week!
We’ll be attending the TSA Research Festival Exhibit Show at the NIH Research Festival Show later this week.
We enjoy meeting our users and if you are attending the show or are just in the area then please do drop by to say hello. If you have any questions, constructive criticism, or features that you would like to see in MacVector, we would like to hear that too. We’ll be at booth #802 in the Exhibit Tent on Parking Lot 10H.
The times of the show are:
– Thursday, October 7 9:30 a.m. – 3:30 p.m.
– Friday, October 8 9:30 a.m. – 2:30 p.m.
Hopefully see you there!
Error 500 when installing MacVector
With some operating systems buying a new computer can mean days migrating all your data and applications over. However, with OS X the Apple Migration Utility almost completely removes the hassle and the pleasure of your new Mac is not diluted by the pain of migration!
However, this utility is not perfect and sometimes when you have imported your applications and data from an older machine the permissions are not set correctly. For MacVector this may mean that you cannot write to the /MacVector/ folder even though you have Administrator privileges. This will manifest itself with a variety of symptoms but the most common one is seeing a “ERROR 500” when trying to activate a license.
This error message you are means that the installation process/license activation (i.e. YOU!) does not have permission to write the license file to the hard drive.
The best way to fix this is to try running a utility that can repair permissions. Although Disk Utility can do this we like to use Onyx (although there are other such utilities about). Run Onyx and choose the Maintenance -> Permissions tab and press execute to repair any permissions on the drive that are not set as they should be. Then try MacVector again
Incidentally it is good practice to run a utility like Onyx at least every month or so.
If this still fails then contact MacVector Support.
Technorati Tags: MacVector
Displaying translations alongside your DNA sequence
There’s a few ways to display an amino acid translation in the same window as your DNA or RNA sequence.
(1) You can show either three or six frame translations directly in the editor. To do so simply press and hold down the STRANDS toolbar button. You’ll see the following menu and be able to select what you want to show:
(2) If you have CDS or exons annotated to your sequence you can display a text view that translates these features and displays them with the sequence. This is the TEXT VIEW button in the toolbar. The TEXT VIEW is highly configurable. For example you can also have each codon spaced out and aligned with its amino acid if you select “BLOCK TO PHASE”. As in the following screenshot. You may find this easier to see the frame from which the amino acid sequence is translated from.
If the sequence that you want to display does not have your desired translation annotated, then it is straightforward to do so.
1 – Highlight the sequence in the EDITOR
2 – Click CREATE in the toolbar to open the FEATURE EDITOR
3 – Choose CDS in the top drop down menu and choose appropriate qualifiers in the bottom section. Click OK
You can also use the ANALYZE > OPEN READING FRAMES… tool to find regions in your sequence. Once run, select the appropriate ORF in the ORF results to highlight the sequence in the editor. You can then go to step 2 above to annotate the sequence.
When MacVector 12 comes out you will also be able to see translations directly in the graphical Map view:
Technorati Tags:
MacVector
AUTUMN SPECIAL OFFER: upgrade your old single network license to 2 standard licenses
Upgrade your old single seat network MacVector license for two standard licenses at the price of a single standard upgrade. A huge savings of more than 50% off the regular price of a network upgrade –plus we will throw in an extra license! If you have an old two-seat network license, we’ll upgrade it to a 4 seat standard license for the price of a 2 standard license upgrade.
Several years ago we changed the way our standard licenses work to make them much more flexible and network-like. No more dongles! You will be provided with a serial number and activation code to activate your license. The same license can be installed on as many machines as you like, but if the computers are on a local network, only one computer can be running MacVector with any particular serial number at one time. Its like having a self-configuring single-user network license except with the added flexibility that you can run the same license on a home computer or laptop without taking the lab’s license or needing to communicate with a central license server. You can also install more than one serial number on the same machine and toggle between licenses if the other one is in use.
In the last 3 ½ years, MacVector, Inc. has released 7 new versions and added many powerful, new features. MacVector 11.1.2 runs natively on all Macs running OSX 10.4 or later, including the latest OS – Snow Leopard. There have been extensive interface changes to make MacVector more OS X like, including custom toolbars for all common operations and analysis functions and a tabbed interface to reduce screen clutter. The new Primer Design function, based on the popular Primer 3 algorithm, gives highly interactive results. You can also now align cDNA/mRNA/ESTs to genomic sequences to aid in splice site identification and analysis of coding regions. We have also added a VectorNTI import feature to import files along with their features directly from VectorNTI databases. Many other enhancements have been made to MacVector – check out this blog post and also this one to see more extensive details of the last two releases.
If you take advantage of this great upgrade offer, you will also receive all new versions of MacVector released over the next year. This will include our upcoming release – v. 12.0, which is due out around the end of the year. There are many enhancements that will be in this release, but the most exciting improvements are in the click-cloning/vector construction area. You will now be able to select across a circular origin, create features that span the split point, and rotate the molecule to any arbitrary new split point. See this blog post for a more comprehensive list of v 12.0 enhancements:
This offer is only valid until the end of November. Please send an email to sales@macvector.com if you would like a quote sent or have any questions and your local sales representative will contact you.